Los Angeles Pierce College Double Stranded DNA Questions

Help me study for my Biology class. I’m stuck and don’t understand.

a) Replicate this sense strand to create a double-stranded DNA helix

TCACCATGAAACTCACACCGGGGAAAACTCTTGCACTTATATTCTTGTTCAAGACCTAGTATAACACATTT


b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by finding the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon.


c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below

5’ UTR:

3’ UTR:

Solution:

10% off for this assignment.

Our Prices Start at $11.99. As Our First Client, Use Coupon Code GET10 to claim 10% Discount This Month!!

Why US?

100% Confidentiality

Information about customers is confidential and never disclosed to third parties.

Timely Delivery

No missed deadlines – 97% of assignments are completed in time.

Original Writing

We complete all papers from scratch. You can get a plagiarism report.

Money Back

If you are convinced that our writer has not followed your requirements, feel free to ask for a refund.